Review



negative control sequence  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc negative control sequence
    Negative Control Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pm41217685-99-8-14?v=Addgene+inc
    Average 94 stars, based on 7 article reviews
    negative control sequence - by Bioz Stars, 2026-07
    94/100 stars

    Images



    Similar Products

    95
    MedChemExpress sirna sequences
    Sirna Sequences, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pm40641109-104-1-45?v=MedChemExpress
    Average 95 stars, based on 1 article reviews
    sirna sequences - by Bioz Stars, 2026-07
    95/100 stars
      Buy from Supplier

    86
    Sangon Biotech negative control sequence
    Negative Control Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pmc13196827-126-15-24?v=Sangon+Biotech
    Average 86 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    86
    Gene Tools Inc negative control sequence
    Negative Control Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pmc13121753-272-25-40?v=Gene+Tools+Inc
    Average 86 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech negative control sirna sequence
    Negative Control Sirna Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pmc12890841-88-17-26?v=Sangon+Biotech
    Average 86 stars, based on 1 article reviews
    negative control sirna sequence - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    86
    Genechem negative control oligonucleotide sequences lv nc
    Negative Control Oligonucleotide Sequences Lv Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pmc12932789-107-5-13?v=Genechem
    Average 86 stars, based on 1 article reviews
    negative control oligonucleotide sequences lv nc - by Bioz Stars, 2026-07
    86/100 stars
      Buy from Supplier

    94
    Addgene inc negative control sequence
    Negative Control Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pm41217685-99-8-14?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-07
    94/100 stars
      Buy from Supplier

    90
    Thermo Fisher negative control sequence without 5’ overhangs
    KEY RESOURCES TABLE
    Negative Control Sequence Without 5’ Overhangs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pmc12210276-48-0-8?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    negative control sequence without 5’ overhangs - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma negative control sirna targeting the sequence ttctccgaacgtgtcacgt
    KEY RESOURCES TABLE
    Negative Control Sirna Targeting The Sequence Ttctccgaacgtgtcacgt, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pmc12001209-103-6-11?v=Shanghai+GenePharma
    Average 90 stars, based on 1 article reviews
    negative control sirna targeting the sequence ttctccgaacgtgtcacgt - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: Neuron

    Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility

    doi: 10.1016/j.neuron.2025.05.023

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , ThermoFisher , Cat # K493600.

    Techniques: Virus, Generated, Cloning, Expressing, Recombinant, Blocking Assay, Plasmid Preparation, Negative Control, Sequencing, Software